Skip to content

Matching Mode - Direct Analysis

Overview

Matching Mode allows you to analyze a specific microRNA against a target mRNA to determine if binding can occur and where the binding sites are located.

Perfect for: - ✅ Validating known microRNA-mRNA interactions - ✅ Testing hypothesis about specific regulators - ✅ Getting detailed binding site information - ✅ Visualizing RNA duplex alignments

How Matching Mode Works

The Algorithm

1. User provides: microRNA + mRNA + Seed Region
   Example: mir-30a + SMAD1 gene + positions 2-7

2. Extract seed from microRNA (positions 2-7)
   Example: GCCAUC

3. Reverse complement the seed
   microRNA:  5'- G C C A U C -3'
   Complement:3'- C G G U A G -5'

4. Search for this sequence throughout mRNA

5. For each match found:
   - Display position in mRNA
   - Show full duplex alignment
   - Calculate pairing statistics

Input Requirements

Component Format Example
microRNA Sequence (19-23 nt) UGUGAAACGUGCGACACUAA
mRNA Sequence (100+ nt) AUGAAACGCGAGCGACGAGC...
Seed Region Positions (start-end) 2-7

Step-by-Step Analysis

1️⃣ Input: microRNA

Choose how to provide the microRNA:

Option A: Database ID

Select: ⊙ DB ID
Enter: MIMAT0007560
Fetches from: miRBase database
Auto-loads: Full mature microRNA sequence
Example IDs: - MIMAT0007560 (mmu-mir-30a) - MIMAT0000062 (mmu-let-7a)

Option B: File

Select: ⊙ File
Choose: [Browse] → select_file.fa
Format: FASTA file
Content: Plain RNA/DNA sequence
Example file: 
>mir-30a
UGUGAAACGUGCGACACUAA

Option C: Direct Sequence

Select: ⊙ Sequence
Paste: UGUGAAACGUGCGACACUAA
Format: Plain text sequence
Notes: Whitespace ignored, case-insensitive

2️⃣ Input: Target mRNA

Choose how to provide the mRNA (important: only 3'UTR is analyzed):

Option A: GenBank ID

Select: ⊙ GenBank ID
Enter: NM_008539
Fetches from: NCBI Entrez
Auto-extracts: 3'UTR region (after stop codon)
Example IDs: - NM_008539 (mouse SMAD1) - NM_002111.8 (human TP53)

⚠️ Note on Position Numbering: When DynamiR extracts the 3'UTR from GenBank, nucleotide position 1 starts at the beginning of the 3'UTR region (right after the CDS stop codon). This is the binding region of interest.

Option B: GenBank File

Select: ⊙ File
Choose: [Browse] → gene.gb
Format: GenBank file (.gb, .gbk) or FASTA file (.fa, .fasta)
Auto-extracts: 3'UTR from CDS annotation (GenBank only)
Benefits: No internet needed, local analysis

⚠️ Note on Position Numbering: When using GenBank files, nucleotide position 1 is set at the start of the 3'UTR region (right after the CDS stop codon). Results report positions relative to this 3'UTR start point.

Option C: FASTA File

Select: ⊙ File
Choose: [Browse] → sequence.fa
Format: FASTA file (.fa, .fasta)
Note: Uses entire sequence (you must provide only 3'UTR)

Option D: Direct Sequence

Select: ⊙ Sequence
Paste: AUGAAACGCGAGCGACGAGC...
Format: Plain text
Important: Paste only the 3'UTR region

3️⃣ Input: Seed Region

Specify which positions of the microRNA must match:

Seed: 2-7

Understanding Seed Positions

microRNA sequence (5' to 3'):
Position: 1  2  3  4  5  6  7  8  9  10...
Base:     U  G  U  A  A  C  G  U  G  C

Seed region 2-7: G U A A C G (highlighted)
              ↑  ↑  ↑  ↑  ↑  ↑
              These 6 positions MUST match

Common Seed Regions

  • 2-7: Most common, 6 nucleotides
  • 2-8: More stringent, 7 nucleotides
  • 1-8: Strictest, 8 nucleotides
  • 2-6: More permissive, 5 nucleotides

Why Seed Matters

The seed region is most critical for: - ✅ Binding specificity - ✅ Thermodynamic stability - ✅ Regulatory effectiveness

4️⃣ Run Analysis

Click the [ Parse ] button

What happens: 1. Validates all inputs 2. Extracts seed region from microRNA 3. Creates reverse complement 4. Searches entire mRNA 5. For each match: calculates full alignment 6. Displays results

Timing: Usually < 1 second

Understanding Results

Result Display

==================================================
Number of binding sites found: 2
==================================================

mRNA binding position: 450
microRNA region:   1- 22
mRNA region:    440-460

3' (22)  CGAGACGUCGAGUGCGACGAU  5' (microRNA): MIMAT0007560
             ||||:||:|||||||||
5' (450) GCUCUGCAGCUCACGCUGCUA  3' (mRNA): NM_008539

Seed region: 2-7 (marked with *)

ALIGNMENT STATISTICS:
  Total base pairs: 18
  Watson-Crick pairs: 16 (strong)
  Wobble pairs: 2 (weak)
  Supplementary pairs outside seed: 10
  Binding strength: 78%

Interpreting Each Line

Element Meaning
mRNA binding position Where in mRNA the binding starts (1-indexed)
microRNA region Which nucleotides of microRNA are shown
mRNA region Which nucleotides of mRNA are shown
\| symbol Watson-Crick pair (strong: A-U or C-G)
: symbol Wobble pair (weaker: G-U)
(space) Mismatch (no pairing)
* marker Seed region (positions 2-7)

Statistics Explained

Watson-Crick Pairs - Strongest, most stable bonds - A pairs with U - C pairs with G - Score: 1.0 point each

Wobble Pairs - Weaker but biologically valid - G pairs with U (non-standard) - Score: 0.5 point each

Binding Strength 

Formula: (WC_pairs × 1.0 + Wobble_pairs × 0.5) / microRNA_length
Example: (16 + 2×0.5) / 22 = 17/22 = 77%

Higher percentage = stronger binding

Interpreting Multiple Binding Sites

If multiple sites are found:

Number of binding sites found: 3

[First site alignment]
...

[Second site alignment]
...

[Third site alignment]
...

Meaning: - microRNA can bind to multiple locations - Each location is independent - Can indicate multiple regulatory pathways - Some sites may be stronger than others

What Results Mean

✅ Positive Result (Sites Found)

Number of binding sites found: 2
Interpretation: - microRNA likely DOES regulate this mRNA - Binding can occur at specified location(s) - The seed region matches perfectly - Additional pairing provides stability

Next Steps: - Validate experimentally (if needed) - Study the identified sites - Check if they're in regulatory regions - Download results for record-keeping

❌ Negative Result (No Sites Found)

No binding sites found with these parameters
Possible Meanings: - microRNA doesn't bind this mRNA with your seed settings - Try a different seed region (2-8, 2-6) - Verify your sequences are correct - Check that mRNA is the 3'UTR region

Exporting Results

Click the 💾 button to save results

What gets saved: - All binding site information - Complete alignments - Statistics and calculations - Input sequence information

Format: Plain text file (.txt)
Default name: matching_results.txt

Use cases: - Archive your analysis - Share with colleagues - Include in publications - Integrate with other tools

Tips & Tricks

🎯 Get Better Results

  1. Use GenBank IDs when possible - ensures 3'UTR extraction
  2. Verify input sequences - typos cause false negatives
  3. Try different seed regions - sometimes 2-8 works better
  4. Check multiple microRNAs - helps find primary regulator

⏱️ Speed Up Analysis

  • Direct sequence input is fastest (no database lookup)
  • Files are faster than IDs (no internet needed)
  • Short sequences analyze faster than long ones

Internet Requirements:

  • ⚡ microRNA Database ID: No internet needed (database is pre-downloaded locally)
  • 🌐 mRNA GenBank ID: Requires internet to fetch from NCBI
  • 📁 Files: No internet needed (local analysis)
  • ✏️ Direct Sequence: No internet needed

🔍 Deeper Exploration

  • Run same microRNA against different mRNAs
  • Test multiple seed regions
  • Use Dynamite mode to find other targets
  • Compare results between different annotations

Common Questions

Q: Why is my seed 2-7 but I see 8 pairing nucleotides?
A: The seed (2-7) MUST match, but often additional nucleotides (position 1 and 8+) also pair. These strengthen the binding but aren't required.

Q: Can I use the full mRNA sequence instead of 3'UTR?
A: Yes, but results may include unrealistic binding sites in coding regions. 3'UTR is where real microRNA binding occurs.

Q: What if I get thousands of binding sites?
A: This can happen with short seeds or very long mRNAs. Try a longer seed region (2-8 instead of 2-7) or more stringent criteria.