Skip to content

Dynamite Mode - Database Scanning

Overview

Dynamite Mode scans your target mRNA against a database of ~48,860 known microRNAs to identify ALL possible microRNA regulators in a single analysis.

Perfect for: - ✅ Discovery: Find unknown microRNA regulators - ✅ Exploration: Screen all possibilities at once - ✅ Research: Identify potential regulatory networks - ✅ Ranking: See which microRNAs are strongest binders

How Dynamite Mode Works

The Algorithm

Input: mRNA sequence + Seed region

For each of the ~48,860 microRNAs in database:
    1. Extract seed region (positions 2-7)
    2. Reverse complement it
    3. Search entire mRNA for matches
    4. If found:
        - Calculate full duplex alignment
        - Score all Watson-Crick pairs
        - Count wobble pairs
        - Compute binding strength %
    5. Store result with ranking score

Output: Sorted table (best to weakest binders)

Processing Timeline

Start scanning...
10% — Estimated time remaining ~ 8.5 s
20% — Estimated time remaining ~ 7.2 s
...
100% — COMPLETE!

Results: 47 microRNAs can bind your mRNA

Step-by-Step Analysis

1️⃣ Input: Target mRNA

Choose how to provide the mRNA:

Option A: GenBank ID

Select: ⊙ GenBank ID
Enter: NM_008539
Fetches from: NCBI Entrez
Auto-extracts: 3'UTR region
Best for: Known genes with published annotations

Option B: GenBank File

Select: ⊙ File
Choose: [Browse] → gene.gb
Format: GenBank file (.gb, .gbk)
Auto-extracts: 3'UTR from CDS annotation
Best for: Local data, custom annotations

Option C: FASTA File

Select: ⊙ File
Choose: [Browse] → sequence.fa
Format: FASTA file (.fa, .fasta)
Note: Uses entire sequence (you manage content)
Best for: Already-prepared 3'UTR sequences

Option D: Direct Sequence

Select: ⊙ Sequence
Paste: AUGAAACGCGAGCGACGAGC...
Format: Plain text
Best for: Quick screening of short regions

2️⃣ Input: Seed Region

Specify the seed region criteria:

Seed: 2-7

Choose from: - 2-7: Standard (most commonly used) - 2-8: More stringent (higher specificity) - 1-8: Strictest (lowest false positives) - 2-6: Permissive (more candidates)

See Matching Mode for detailed explanation.

3️⃣ Run Full Scan

Click [ Parse ] button

What Happens: 1. Validates mRNA input 2. Opens database (~48,860 microRNAs) 3. Tests each microRNA against your mRNA 4. Progress window shows real-time status 5. Computes results in background (non-blocking UI) 6. Displays sorted results when complete

Typical Duration: 5-10 seconds

4️⃣ Monitor Progress

A progress window appears:

Scanning Progress Popup

What it shows: - Percentage of database scanned - Visual progress bar - Estimated time to completion - Updated in real-time

During scanning: - ✅ Main window stays responsive - ✅ You can view previous results - ✅ Cannot start new scan until complete

Understanding Results

Result Table Format

Scanning Progress Popup

Column Explanations

Column Meaning Example
Accession microRNA ID (miRBase) MIMAT0000062
Score Total pairing strength 15.5 (higher = better)
Seed Positions used for search 2-7 (as specified)
Bound Total nucleotides paired 8
Bind% Percentage of microRNA that pairs 80%
Position Where binding starts in mRNA 450
Length microRNA sequence length 22 nucleotides
microRNA Seq Actual seed sequence CUGGGCAACAUAGCGAGACCCC
Other Pairs Positions with pairs outside seed 8-12,14-16

Result Ranking

Results are automatically sorted by:

  1. Primary: Score (highest first) = strongest binders
  2. Secondary: Binding % (highest first) = most coverage

What this means: - ✅ Top results are most likely genuine binders - ✅ Each result represents a possible regulator - ✅ You can quickly identify top candidates

What High Results Mean

Multiple Top Binders

Results: 47 microRNAs might3 bind your mRNA
Top 10 shown above...
Meaning: - mRNA is heavily regulated - Multiple regulatory pathways - Target gene is biologically important - Complex regulatory network

Implication: Important for gene expression control

Single Strong Binder

Results: 3 microRNAs can bind your mRNA
Only 1 with good score...
Meaning: - Specific microRNA-mRNA pair - Clear regulatory relationship - Primary regulator identified - Simpler network

Implication: Primary regulatory mechanism identified

No Results

No microRNA binding sites found with these parameters
Possible Meanings: - This mRNA isn't microRNA-regulated - All matches are weak/non-specific - Wrong seed region - mRNA not in 3'UTR format

Troubleshooting: Try different seed (2-8, 2-6)

Exporting Results

Click 💾 button in top-right corner

What gets saved: - Complete results table - All statistics - Input parameters - Analysis timestamp

Format: Plain text file (.txt)
Default name: dynamite_results.txt

Use: Archive, sharing, further analysis

Understanding the Biology

Why Multiple Binders?

Many genes are regulated by multiple microRNAs: - Diversity: Different cellular conditions - Redundancy: Multiple regulatory pathways - Specificity: Different targeting combinations - Fine-tuning: Gradual expression adjustment

What Makes a Good Binder?

  1. Seed perfect match (positions 2-7)
  2. Additional pairing (strengthens binding)
  3. Energetically favorable (stable duplex)
  4. In 3'UTR region (accessible location)

Seed Region Importance

  • Seed (2-7): MUST match exactly
  • Position 1 & 8+: Extra pairing, bonus stability
  • Perfect alignment: Not typically required
  • Wobble pairs: Acceptable, weaken binding slightly

Advanced Usage

Comparing Different Seed Regions

Run analysis 3 times: 1. Seed 2-7 (standard) 2. Seed 2-8 (stringent) 3. Seed 2-6 (permissive)

Compare results: - 2-7: Balanced hit rate - 2-8: Fewer results, higher confidence - 2-6: More results, include marginal binders

Finding Specific microRNAs

Results are sorted by score. To find a specific microRNA: 1. Run Dynamite scan 2. Export results 3. Search exported file for microRNA name/ID 4. Note its rank and score

Focusing on 3'UTR Analysis

Best practice: 1. Use GenBank ID (auto-extracts 3'UTR) 2. Or provide GenBank file 3. Ensures biological relevance 4. Avoid false positives in coding region

Tips & Tricks

🎯 Optimize Your Analysis

  1. Start with 2-7 seed - most balanced
  2. Review top 5 results - usually most relevant
  3. Check positions - biological plausibility
  4. Use GenBank IDs - automatic 3'UTR extraction

⚡ Speed Up Scanning

  1. Pre-filter sequences - shorter = faster
  2. Use 2-8 seed - slightly fewer matches = faster
  3. Local files - faster than downloading IDs

🔍 Interpret Thoroughly

  1. Top 3-5 results - most trustworthy
  2. Position analysis - check if in 3'UTR
  3. Known interactions - validate against literature
  4. Binding strength - score correlates with strength

Common Patterns

Pattern 1: Let-7 Family Dominance

Top results include multiple let-7 family members
Indicates: Strong conservation, common target

Pattern 2: Mixed Families

Results from diverse microRNA families
Indicates: Complex regulation, developmental importance

Pattern 3: Single Clear Winner

One microRNA far above others
Indicates: Specific primary regulator

Troubleshooting

Q: Why is analysis slow?
A: Scanning 48,860 microRNAs takes time. Typical: 1-5 minutes. Be patient!

Q: Can I get results in different order?
A: Results are always sorted by score. Export to .txt to manipulate manually.

Q: What if I get too many results?
A: Try seed 2-8 (more stringent). Or manually filter high-score results.

Q: Can I search subset of microRNAs?
A: Currently scans full database. Use Matching mode for specific microRNAs.