Biological Concepts

What are microRNAs?

Basic Definition

microRNAs (miRNAs) are small RNA molecules (~22 nucleotides) that regulate gene expression by binding to messenger RNA (mRNA) and controlling their stability and translation.

microRNA: 5'- UGUGAAACGUGCGACACUAA -3'  (22 nt)
         Small, regulatory RNA molecule

Where They Come From

1. Transcribed from DNA as long precursors
2. Processed by cellular machinery
3. Loaded into RISC complex (regulatory protein)
4. Mature form is the active ~22 nucleotide molecule
5. Binds to target mRNAs

Their Role in Cells

• 🎯 Gene regulation: Control when proteins are made
• 🛑 Silencing: Reduce or block protein production
• 🔄 Fine-tuning: Adjust gene expression levels
• 🧬 Development: Regulate developmental processes
• ⚖️ Homeostasis: Maintain cellular balance

---

What is mRNA?

Basic Definition

Messenger RNA (mRNA) carries genetic instructions from DNA to ribosomes, where proteins are synthesized.

DNA → mRNA → Protein
     (transcription)  (translation)

mRNA Structure

5' cap ─── 5'UTR ─── CDS ─── 3'UTR ─── poly(A) tail
        (untranslated) (protein coding) (untranslated)

3'UTR: Where microRNAs Bind

The 3' Untranslated Region (3'UTR) is the critical zone: - Located AFTER the protein-coding sequence - Not translated into protein - Contains microRNA binding sites - ~100-1000+ nucleotides typically - Multiple microRNAs can bind one 3'UTR

Why here? - ✅ Accessible to microRNAs - ✅ Doesn't interfere with protein production - ✅ Regulatory region (intended for control) - ✅ Evolutionarily conserved

---

How Binding Works

Step 1: Seed Region Recognition

The seed region (nucleotides 2-7 of microRNA) is critical:

microRNA:  5'- U GUGAAACGUGCGACACUAA -3'
Position:     1 2345678910...
                 └─seed region─┘
              (positions 2-7)

The seed is short (6 nucleotides) but extremely important: - ✅ Provides specificity - ✅ Determines target mRNA selection - ✅ Must be complementary to mRNA - ✅ Watson-Crick base pairing

Step 2: Finding the Match

The seed reverse complement searches for matching sequences:

microRNA seed:    5'- G U A A C G -3'
Reverse:          3'- G A U U C G -5'
Complement:       3'- C G U A G C -5'

Looking for in mRNA:
3'- C G U A G C -5'   ← This sequence in mRNA
5'- G C A U C G -3'   (displayed 5' to 3')

Step 3: Duplex Formation

When a match is found, base pairing occurs:

microRNA:  5'- U GUA ACG UGC GA -3'
           ··· ││||::│││││ ··
mRNA:      3'- A CAU UGC ACG CU -5'

│ = Watson-Crick pair (strong)
: = Wobble pair (G-U, weaker)
· = Mismatch (no pairing)

Step 4: Functional Outcome

Once bound, the microRNA-mRNA complex: - 🛑 Recruits degradation machinery - 🔇 Silences translation - ⚡ Reduces protein levels - 📉 Effectively "turns off" the gene

---

Base Pairing Rules

Watson-Crick Pairs (Strong)

Standard RNA base pairing:

Adenine (A) pairs with Uracil (U):     A-U
   ││  
Guanine (G) pairs with Cytosine (C):   G-C
   ││

Characteristics: - ✅ Most stable - ✅ Standard geometry - ✅ Full score in binding calculations - ✅ Preferred by RISC complex

Example:

microRNA: A
mRNA:     U
Result: Watson-Crick pair (score: 1.0)

Wobble Pairs (Weaker)

Special non-standard pairing:

Guanine (G) can pair with Uracil (U):  G-U
   :

Characteristics: - ⚠️ Less stable than Watson-Crick - ⚠️ Non-standard geometry - ⚠️ Partial score in calculations - ✅ Biologically tolerated - ✅ Increases binding flexibility

Example:

microRNA: G
mRNA:     U
Result: Wobble pair (score: 0.5)

No Pairing (Mismatch)

Adenine (A) with Cytosine (C):     A-C ✗

Meaning: - ❌ Cannot pair - ❌ Mismatch - ❌ No contribution to binding strength - ✅ Allowed in supplementary regions

---

Seed Region Specificity

Why Seed Matters Most

The seed determines target selection:

Position:        1  2  3  4  5  6  7  8  9 10...
microRNA:        U  G  U  A  A  C  G  U  G  C
                    └──seed (2-7)──┘
                 MUST match exactly!

The seed requirement: - ✅ Positions 2-7 MUST be complementary - ✅ This narrowing is what gives specificity - ✅ Thousands of mRNAs, but correct seed matches are rare - ✅ Even one mismatch in seed = no binding

Alternative Seed Definitions

Researchers sometimes use: - 2-7: Standard (6 nt) - most common - 2-8: Extended (7 nt) - more stringent - 1-8: Strictest (8 nt) - highest specificity - 2-6: Relaxed (5 nt) - more permissive

This tool uses 2-7 by default but allows configuration.

---

Supplementary Pairing

Beyond the Seed

After the seed matches, additional nucleotides may pair:

microRNA:  5'- U GGUAACGUGCGACAC UAA -3'
Position:     1  2345678910111213141516171819...
Seed (2-7):     └─required─┘
Extra pairing:       └────optional─────┘

Outside seed (1, 8-22):
- Not required for binding
- But strengthen the interaction
- Show in results as "Other Pairs"

Impact of Supplementary Pairs

Situation	Result
Seed only, no extra	Weak binding, may not be functional
Seed + some extra	Moderate binding, likely functional
Seed + extra pairing	Strong binding, likely functional

Scoring System

Total Score = (WC pairs × 1.0) + (Wobble pairs × 0.5)

Example 1 (strong):
  Watson-Crick: 16 pairs × 1.0 = 16.0
  Wobble: 2 pairs × 0.5 = 1.0
  Total: 17.0 (strong)

Example 2 (weak):
  Watson-Crick: 6 pairs × 1.0 = 6.0
  Wobble: 0 pairs × 0.5 = 0
  Total: 6.0 (weak)

---

3'UTR Importance

Why Only 3'UTR?

microRNAs bind specifically to 3'UTR because:

5' cap ─── 5'UTR ─── CDS ─── 3'UTR ─── poly(A)
                   (protein code)
         Blocked:          ✅ Accessible:
         - In translation   - Post-transcriptional
         - Ribosome there    - Exposed to RISC
         - Not accessible   - Regulatory purpose

Accessibility

• Coding sequence: Ribosome blocking access (physically)
• 3'UTR: Free to interact with regulatory proteins
• Ribosome: Only reads 5'UTR through CDS
• RISC complex: Finds microRNAs in 3'UTR

Regulatory Effect

microRNA binding to 3'UTR causes: 1. mRNA destabilization: Triggers degradation 2. Translation block: Prevents protein synthesis 3. Overall effect: Reduced protein levels

---

Biological Reality

How Many microRNAs Target One Gene?

Typical mRNA is targeted by 5-20 different microRNAs:

mRNA 3'UTR:
┌─ microRNA A site ─┬─ microRNA B site ─┬─ microRNA C site ┬─...
│ CCGAUGC           │ GCAUU              │ ACGUAG            │
└──────────────────┴───────────────────┴────────────────────┴─...

Result: - Multiple regulatory pathways - Combinatorial control - Gene expression fine-tuning - Multiple regulatory pathways

One microRNA Targets Multiple Genes

A single microRNA targets 200-300 different mRNAs:

mir-30a ┬─→ mRNA 1 → Protein 1 ↓
        ├─→ mRNA 2 → Protein 2 ↓
        ├─→ mRNA 3 → Protein 3 ↓
        └─→ ... 200+ targets

Result: - Coordinated gene silencing - Pathway-level effects - Disease involvement when dysregulated - Central in gene regulatory networks

Examples of Biological Importance

microRNA	Targets	Function
let-7	Oncogenes	Tumor suppression
mir-122	Viral RNA	Antiviral defense
mir-29	Collagen	ECM regulation
mir-200	E-cadherin	Epithelial-mesenchymal transition

---

When This Tool Is Used

In Research

1. Validation: Confirm predicted interactions
2. Discovery: Find new targets for genes of interest
3. Network analysis: Map regulatory pathways
4. Drug development: Identify therapeutic targets

In Diagnosis

1. Biomarkers: Dysregulated microRNAs indicate disease
2. Classification: microRNA signatures classify cancer subtypes
3. Prognosis: microRNA levels predict outcomes

In Development

1. Gene regulation: microRNAs control developmental timing
2. Differentiation: Control cell fate decisions
3. Homeostasis: Maintain cellular stability

---

Assumptions & Limitations

This Tool Assumes

✅ Watson-Crick pairing follows standard rules
✅ Wobble G-U pairs are possible
✅ Seed region (2-7) is most critical
✅ Accessibility is sufficient in 3'UTR
✅ RNA sequences are correctly provided

What This Tool Does NOT Include

❌ mRNA secondary structure (can block access)
❌ Protein binding sites (compete with microRNAs)
❌ Cellular localization effects
❌ Tissue-specific expression patterns
❌ Thermodynamic free energy calculations
❌ Evolutionary conservation

Real-World Complexity

Actual microRNA function depends on: - 📍 mRNA secondary structure - 🔬 Protein-RNA interactions - 🧬 Sequence context effects - ⏰ Cellular conditions - 🔄 Competition with other molecules

Bottom Line: This tool identifies potential binding sites. Experimental validation is recommended for important findings.